reference sequence (refseq) gene transcripts Search Results


97
ATCC c guilliermondii atcc 6260 reference strain whole genome
C Guilliermondii Atcc 6260 Reference Strain Whole Genome, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c guilliermondii atcc 6260 reference strain whole genome/product/ATCC
Average 97 stars, based on 1 article reviews
c guilliermondii atcc 6260 reference strain whole genome - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

95
Chem Impex International trifluoro acetic acid tfa
Trifluoro Acetic Acid Tfa, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trifluoro acetic acid tfa/product/Chem Impex International
Average 95 stars, based on 1 article reviews
trifluoro acetic acid tfa - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

97
Bio-Rad precision plus protein dual color standards biorad
Precision Plus Protein Dual Color Standards Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/precision plus protein dual color standards biorad/product/Bio-Rad
Average 97 stars, based on 1 article reviews
precision plus protein dual color standards biorad - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

90
GenScript corporation genes encoding α-ketoisocaproate dioxygenase from rattus norvegicus (rnkicd, ncbi reference sequence: np_058929.1)
Genes Encoding α Ketoisocaproate Dioxygenase From Rattus Norvegicus (Rnkicd, Ncbi Reference Sequence: Np 058929.1), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/genes encoding α-ketoisocaproate dioxygenase from rattus norvegicus (rnkicd, ncbi reference sequence: np_058929.1)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
genes encoding α-ketoisocaproate dioxygenase from rattus norvegicus (rnkicd, ncbi reference sequence: np_058929.1) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biotechnology Information reference sequence (refseq) database
Reference Sequence (Refseq) Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reference sequence (refseq) database/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
reference sequence (refseq) database - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Clinical and Laboratory Standards Institute 16s rrna gene sequence analysis
16s Rrna Gene Sequence Analysis, supplied by Clinical and Laboratory Standards Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s rrna gene sequence analysis/product/Clinical and Laboratory Standards Institute
Average 90 stars, based on 1 article reviews
16s rrna gene sequence analysis - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Clinical and Laboratory Standards Institute rmlst scheme
Rmlst Scheme, supplied by Clinical and Laboratory Standards Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rmlst scheme/product/Clinical and Laboratory Standards Institute
Average 90 stars, based on 1 article reviews
rmlst scheme - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Jackson Laboratory primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt
Primer Name Nucleotide Sequence (5′ → 3′) Product Size Reference Gfap Cre Oimr1084 Oimr1085 Gcggtctggcagtaaaaactatc Gtgaaacagcattgctgtcactt, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt/product/Jackson Laboratory
Average 90 stars, based on 1 article reviews
primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Supranational Reference Laboratories long-read pacbio sequencing
Long Read Pacbio Sequencing, supplied by Supranational Reference Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/long-read pacbio sequencing/product/Supranational Reference Laboratories
Average 90 stars, based on 1 article reviews
long-read pacbio sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Gallus BioPharmaceuticals human reference sequences
Human Reference Sequences, supplied by Gallus BioPharmaceuticals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human reference sequences/product/Gallus BioPharmaceuticals
Average 90 stars, based on 1 article reviews
human reference sequences - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biotechnology Information ncbi reference sequence database
Ncbi Reference Sequence Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ncbi reference sequence database/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
ncbi reference sequence database - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Kazusa Genome Technologies custom reference sequence
Custom Reference Sequence, supplied by Kazusa Genome Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom reference sequence/product/Kazusa Genome Technologies
Average 90 stars, based on 1 article reviews
custom reference sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results